Gene Information: lron-12

Namelron-12 View on WormBase
Species C. elegans
SequenceY75B8A.5
Genetic positionIII:14.97 +/- 0.000 cM
Genomic positionIII: 12114565..12118481

Strains carrying this gene

Strain Genotype Description
RB1750 Y75B8A.5(ok2240) III. Y75B8A.5 Homozygous. Outer Left Sequence: tcttgaaagggtgttttgcc. Outer Right Sequence: gtaaggaagggcttccaggt. Inner Left Sequence: tttcatttctgggcgttttc. Inner Right Sequence: ttccgatgtgcaaaaattca. Inner Primer PCR Length: 3181. Deletion size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4261 lron-12(gk5345[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Homozygous viable. Deletion of 2072 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTCTCCGATTGTATTTCTCAATATTTTAAG; Right flanking sequence: GGACAAGTGTCTCGGAGGGCATTTGAATAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.