Gene Information: dod-18
| Name | dod-18 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C54G4.6 |
| Genetic position | I:2.42 +/- 0.001 cM |
| Genomic position | I: 8019578..8020901 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8114 | dod-18(sy1190) I. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dod-18; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCATTGAAACAGCTAAAGGAAAATTGACGACTA Right flanking sequence: TTGTGGAAGAAATGAAAAGAAAAGAGgtatagtta inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGGAAAATTGACGACTATTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| RB1418 | dod-18&C54G4.7(ok1615) I. | C54G4.6, C54G4.7. Homozygous. Outer Left Sequence: TCACAATGCTATCGGGTCAA. Outer Right Sequence: GGAAAGAGAGTGGCATGAGG. Inner Left Sequence: ACAATCCGAGAAACTCGTGG. Inner Right Sequence: CTTGCGAAAAATCCCTCGTA. Inner Primer PCR Length: 2192 bp. Deletion Size: 820 bp. Deletion left flank: CATTGGCATCTGTTGGTTTTCCAATAATTT. Deletion right flank: AATAATTCTCAGAAATATTCAAAAAATGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |