Gene Information: nlp-77
Name | nlp-77 View on WormBase |
---|---|
Species | C. elegans |
Sequence | C06A8.3 |
Genetic position | II:0.57 +/- 0.000 cM |
Genomic position | II: 7790591..7791375 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
PS8191 | nlp-77(sy1216) II. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-77; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACAACCAGCCGGAGGTCAAGATGTTCCACCATTC Right flanking sequence: CTTCGTAATGCCACTCCAGCTCAACTTCAGAGCTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGTGGCATTACGAAGGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
RB1358 | C06A8.3(ok1525) II. | C06A8.3 Homozygous. Outer Left Sequence: ctggtcaacttcagcgaaca. Outer Right Sequence: ttggcactcacatcagaagc. Inner Left Sequence: ggacatccctcatcagtcgt. Inner Right Sequence: gtcctttttcaaatccgcaa. Inner Primer PCR Length: 2211. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |