Gene Information: nlp-77

Namenlp-77 View on WormBase
Species C. elegans
SequenceC06A8.3
Genetic positionII:0.57 +/- 0.000 cM
Genomic positionII: 7790591..7791375

Strains carrying this gene

Strain Genotype Description
PS8191 nlp-77(sy1216) II. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-77; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACAACCAGCCGGAGGTCAAGATGTTCCACCATTC Right flanking sequence: CTTCGTAATGCCACTCCAGCTCAACTTCAGAGCTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGTGGCATTACGAAGGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
RB1358 C06A8.3(ok1525) II. C06A8.3 Homozygous. Outer Left Sequence: ctggtcaacttcagcgaaca. Outer Right Sequence: ttggcactcacatcagaagc. Inner Left Sequence: ggacatccctcatcagtcgt. Inner Right Sequence: gtcctttttcaaatccgcaa. Inner Primer PCR Length: 2211. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807