Gene Information: cyp-37A1
| Name | cyp-37A1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F01D5.9 |
| Genetic position | II:22.18 +/- 0.082 cM |
| Genomic position | II: 14013819..14016965 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RB846 | F01D5.9(ok673) II. | F01D5.9. Homozygous. Outer Left Sequence: ATCATCAGTTTTCTTGGCGG. Outer Right Sequence: TTTTGCAGTGAGCGAAAATG. Inner Left Sequence: CTCTCCATTTCTCACCGCTC. Inner Right Sequence: TTCATGCGGAAATTGTTGAA. Inner primer WT PCR product: 2808. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| SOZ300 | cyp-37A1(ssd9) II. | ssd9 is a Class III supersized lipid droplet mutation. 68bp deletion 5' flanking sequence: cacacatccgtacgtggtgg. 3' flanking sequence: cgacaactgattggttatga References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846. cyp-37A1 previously known as drop-1. |