| CZ18412 |
juSi94 II; rps-18(ok3353) IV; glo-4(ok623) V; juEx5515. |
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5515 [unc-25p::GFP1-10 + unc-25p::mCherry::rab-3 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. GABAergic motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in neurons, and GABAergic motor neuron-specific expression of mCherry::rab-3. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376. |
| NM210 |
rab-3(y250) II. |
Ric; very slightly slow and loopy movement. Aberrant EPG. |
| NM211 |
rab-3(y251) II. |
Ric; very slightly slow and loopy movement. Aberrant EPG. |
| NM2777 |
aex-6(sa24) I; rab-3(js49) II. |
|
| NM4431 |
rep-1(ok3296) jsIs682/sC1 [s2303) [dpy-1(s2170)] jsIs682 III. |
jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)] III. rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation. |
| NM791 |
rab-3(js49) II. |
Ric; very slightly slow and loopy movement. Aberrant EPG. |
| XA4832 |
unc-13(e1091) I; rab-3(y251) II. |
Previously called MA1132. |