Gene Information: gpa-14
| Name | gpa-14 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | B0207.3 |
| Genetic position | I:0.49 +/- 0.004 cM |
| Genomic position | I: 5942390..5945651 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| NL788 | gpa-14(pk347) I. | [NOTE: (07/16/2015) The correct genotype of this strain is gpa-14(pk347) I. not gpa-14(pk342) as previously reported.] |
| VC4088 | gpa-14(gk5176) I. | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5176 mutation is T->A, flanking sequences ACCTCTGGATCCAATTGAACATATTACATA and GAAATTGATGAAATCTATGCTCCAATGTCT. |