Gene Information: rskn-1
| Name | rskn-1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T01H8.1 |
| Genetic position | I:2.96 +/- 0.005 cM |
| Genomic position | I: 8573852..8580205 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| COP1918 | rskn-1(knu796) I. | Superficially wild-type. knu796 is a K216E point mutation mimicking a patient allele associated with Coffin-Lowry syndrome. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information. |
| NL742 | rskn-1(pk209::Tc1) mut-2(r459) I. | Dpyish. Primers used to isolate pk209 are: cgatcctcgacagtttgaactgc & cgagattcagggcatgtctatgc. |