| NL728 |
cey-1(pk81) II. |
Tc1 allele. |
| RAF5 |
cey-1(rrr12) II. |
Slightly pale appearance. Reference: Arnold A, et al. Nucleic Acids Res. 2014 Dec 1;42(21):13353-69. |
| VC1310 |
cey-1(ok1805) II. |
F33A8.3. Superficially wild type. External left primer: CCGTTTCTCGAAAGTGCTTC. External right primer: TACACTGACCGCTGCTCATC. Internal left primer: AACCGGAGAAGGAGAAGCTC. Internal right primer: GGTCAGCTTACACACTCGCA. Internal WT amplicon: 2614 bp. Deletion size: 539 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3925 |
cey-1(gk5004[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. |
Homozygous viable. Deletion of 1155 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTCTCTTAATTACTACGAGTGTTACTGG; Right flanking sequence: CGGCTGTTACTTCGTGTGGCGCGACACAAC. See WormBase Variation gk5004 for details. |