| MU1085 |
bwIs2. |
bwIs2 [flp-1::GFP + rol-6(su1006)]. Segregates >90% Rollers and 100% GFP+. Expresses GFP in the AVK neurons. Insertion site not mapped. |
| NL242 |
mut-2(r459) I; flp-1(pk41::Tc1) IV. |
TTTAAAACG TA CTTACCTTT |
| NY16 |
flp-1(yn4) IV. |
Loopy, uncoordinated movement. Hyperactive. Nose touch-insensitive. Osm. |
| NY7 |
flp-1(yn2) IV. |
Loopy, uncoordinated movement. Hyperactive. Nose touch-insensitive. Osm. |
| OH4130 |
bwIs2 vab-1(dx31) II; wrk-1(ok695) X. |
bwIs2 [flp-1::GFP + rol-6(su1006)]. Segregates >90% Rollers and 100% GFP+. Expresses GFP in the AVK neurons. Insertion site not mapped. |
| OH4133 |
bwIs2 II; vab-1(dx31) II. |
bwIs2 [flp-1::GFP + rol-6(su1006)]. Segregates >90% Rollers and 100% GFP+. Expresses GFP in the AVK neurons. Insertion site not mapped. |
| OH4137 |
bwIs2 II; wrk-1(tm1099) X. |
bwIs2 [flp-1::GFP + rol-6(su1006)]. Segregates >90% Rollers and 100% GFP+. Expresses GFP in the AVK neurons. Insertion site not mapped. |
| OH4142 |
bwIs2 II; wrk-1(ok695) X. |
bwIs2 [flp-1::GFP + rol-6(su1006)]. Segregates >90% Rollers and 100% GFP+. Expresses GFP in the AVK neurons. Insertion site not mapped. |
| PS8997 |
flp-1(sy1599) IV. |
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of flp-1;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GACTCTGCTCTACCAAGTAGGGTTATTACTCCTTGT
Right flanking sequence: GGCAGCTACTTATAAGgtttctttcttgatttaat
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CCTTATAAGTAGCTGCCACA
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| RB2106 |
F23B2.5(ok2781) IV. |
F23B2.5 Homozygous. Outer Left Sequence: atgtgtcccgttttggatgt. Outer Right Sequence: agcgtccgaatctgaagaaa. Inner Left Sequence: cggtacttgcaaagaaggct. Inner Right Sequence: ctgcagatcgttttccgaat. Inner Primer PCR Length: 1193. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| RB2126 |
F23B2.5(ok2811) IV. |
F23B2.5 Homozygous. Outer Left Sequence: atgtgtcccgttttggatgt. Outer Right Sequence: agcgtccgaatctgaagaaa. Inner Left Sequence: cggtacttgcaaagaaggct. Inner Right Sequence: cggtacttgcaaagaaggct. Inner Primer PCR Length: 1193. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC1909 |
flp-1(ok2505) IV/nT1 [qIs51] (IV;V). |
F23B2.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2505 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGTGTCCCGTTTTGGATGT. External right primer: AGCGTCCGAATCTGAAGAAA. Internal left primer: CGGTACTTGCAAAGAAGGCT. Internal right primer: CTGCAGATCGTTTTCCGAAT. Internal WT amplicon: 1194 bp. Deletion size: 475 bp. Deletion left flank: GTATACTATTCATTTAAAAAATATTGCCTA. Deletion right flank: TTTCTGATAAAAAAGAGCACAACTTGGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |