Gene Information: mir-63
| Name | mir-63 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C16H3.5 |
| Genetic position | X:24.44 +/- 0.040 cM |
| Genomic position | X: 17598765..17598868 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| MT18016 | nDf63 III; mir-63(n4568) X. | Both deletions are homozygous by PCR. mir-63, mir-229, mir-64, mir-65, and mir-66 are related in sequence. nDf63 removes mir-229, mir-64, mir-65, and mir-66. nDf63 was outcrossed 6x; n4568 has been outcrossed 2x. Reference: Curr Bio (2010) doi:10.1016/j.cub.2009.12.051. |
| VT1289 | mir-63(n4568) X. | Deletion breakpoints are: TAAAAATTCAAAGAATTGATATCTGAACA / CTACTATGCCACC...CCAAAGGGGTGG / TTTTCAACAATTTCACCACTGGCGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |