Gene Information: mir-249

Namemir-249 View on WormBase
Species C. elegans
SequenceY48D7A.3
Genetic positionX:-12.66 +/- 0.001 cM
Genomic positionX: 3006440..3006536

Strains carrying this gene

Strain Genotype Description
MT16848 mir-249(n4983) X. Deletion breakpoints are:TGCCAACTGGATTGAACAAAACAACT / TGCACACAAGAGAGAGGTCCACCTAGCAA...AGATAAGTCGTACATCACTTTAT / CTGTTTAATGGATTAGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.