Gene Information: mir-355

Namemir-355 View on WormBase
Species C. elegans
SequenceT27D12.5
Genetic positionII:4.07 +/- 0.003 cM
Genomic positionII: 11833536..11833645

Strains carrying this gene

Strain Genotype Description
MT16316 mir-355(n4618) II. Deletion breakpoints are:TGTGTCTATGAAATTAATTC / TTATATCAACTCTAATTAT...TTTTGGGAAAATGAAC / GATTAAACATTTTTTTTA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.