Gene Information: mir-244
| Name | mir-244 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T04D1.5 |
| Genetic position | I:-0.98 +/- 0.017 cM |
| Genomic position | I: 4684316..4684414 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| MT16033 | mir-244(n4367) I. | Deletion breakpoints are: CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| MT16696 | mir-244(n4367) I. | Deletion breakpoints are:CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |