Gene Information: mir-240

Namemir-240 View on WormBase
Species C. elegans
SequenceC39D10.10
Genetic positionX:-1.04 +/- 0.008 cM
Genomic positionX: 7882622..7882718

Strains carrying this gene

Strain Genotype Description
MT15873 mir-240(n4541) X. Deletion breakpoints are:TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT18043 mir-240&mir-786(n4541) X. Deletion breakpoints are: TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.