Gene Information: mir-246

Namemir-246 View on WormBase
Species C. elegans
SequenceZK593.10
Genetic positionIV:4.76 +/- 0.001 cM
Genomic positionIV: 10940134..10940230

Strains carrying this gene

Strain Genotype Description
MT15020 mir-246(n4636) IV. Deletion breakpoints are:GATACATCGGTGCAATGAAGA / CATCATCAGATAATATTCTCAA...ATGTTTCGGGTAGGAGCTGT / TCAAACTTTGGACATTGGCATC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.