Gene Information: mir-360

Namemir-360 View on WormBase
Species C. elegans
SequenceY23B4A.3
Genetic positionX:-4.07 +/- 0.013 cM
Genomic positionX: 5919149..5919258

Strains carrying this gene

Strain Genotype Description
MT15018 mir-360(n4635) X. Deletion breakpoints are:ACGTGCTGTAAAAATTTGCGG / ATACCAAGCCTACAGTTGATTT...GGGACTTTGGGCGGCTTA / AAGTGTCACTGGTCTGGACG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.