Gene Information: mir-257
| Name | mir-257 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y102A5D.4 |
| Genetic position | V:12.80 +/- 0.002 cM |
| Genomic position | V: 17140668..17140769 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| MT14682 | mir-257(n4548) V. | Deletion breakpoints are:GACCTTGGACTTCAGCACATCCGGTTTTCCA / CTCGGAACTTGACG....CCTGCAGTTCTTCCAT / GATGTACTCAGGGCCTTTAATTTTGTACATGCTCCATAGGAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |