| MT14531 |
prg-2(nDf57) IV. |
Deletion breakpoints: ATCGGGATGAAGTTTGCAAA//AATCTAGAATACCGATTTCG. Transposon silencing abnormal. Only enhanced transposon activity observed in n4503; nDf57 mutants compared to n4503 (not in nDf57 mutants alone). |
| SX166 |
prg-1(n4357) I; prg-2(n4358) unc-22(st136) IV. |
Transposon silencing normal. |
| SX278 |
prg-1(n4357) I; prg-2(n4358) unc-22(r765) IV. |
Transposon silencing normal. |
| SX494 |
prg-1(n4503) I; prg-2(nDf57) unc-22(r750) IV. |
Transposon silencing abnormal. Twitchers. |
| SX523 |
prg-1(n4357) I; prg-2(n4358) IV. |
21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Sterile at 25.5C; maintain at 20C or below. |
| SX9 |
prg-1(n4503) I; prg-2(nDf57) IV. |
Reduced brood size. Transposon silencing abnormal. Endogenous transposase levels increased. |
| SX921 |
prg-2(n4358) IV. |
Transposon silencing abnormal. Superficially WT. Deletion breakpoints: CGGTTCGTTTTCTTGAATCG//CCTTTAAGTTTTCATCTCAA. |
| VC799 |
prg-2(ok1328) IV. |
C01G5.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| WM162 |
prg-2(tm1094) IV. |
|