Gene Information: prg-2

Nameprg-2 View on WormBase
Species C. elegans
SequenceC01G5.2
Genetic positionIV:3.20 +/- 0.000 cM
Genomic positionIV: 6526962..6529802

Strains carrying this gene

Strain Genotype Description
MT14531 prg-2(nDf57) IV. Deletion breakpoints: ATCGGGATGAAGTTTGCAAA//AATCTAGAATACCGATTTCG. Transposon silencing abnormal. Only enhanced transposon activity observed in n4503; nDf57 mutants compared to n4503 (not in nDf57 mutants alone).
SX166 prg-1(n4357) I; prg-2(n4358) unc-22(st136) IV. Transposon silencing normal.
SX278 prg-1(n4357) I; prg-2(n4358) unc-22(r765) IV. Transposon silencing normal.
SX494 prg-1(n4503) I; prg-2(nDf57) unc-22(r750) IV. Transposon silencing abnormal. Twitchers.
SX523 prg-1(n4357) I; prg-2(n4358) IV. 21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Sterile at 25.5C; maintain at 20C or below.
SX9 prg-1(n4503) I; prg-2(nDf57) IV. Reduced brood size. Transposon silencing abnormal. Endogenous transposase levels increased.
SX921 prg-2(n4358) IV. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: CGGTTCGTTTTCTTGAATCG//CCTTTAAGTTTTCATCTCAA.
VC799 prg-2(ok1328) IV. C01G5.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
WM162 prg-2(tm1094) IV.