| CZ25708 |
prg-1(ju1574) I. |
Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT:
[GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer:
GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014. |
| MT14521 |
prg-1(n4503) I. |
Transposon silencing abnormal. |
| NL4110 |
prg-1 (pk2298) I. |
Superficially wildtype. |
| SX157 |
prg-1(n4357) I; unc-22(st136) IV. |
Transposon silencing normal. |
| SX158 |
prg-1(n4357) I; unc-22(r750) IV. |
Twitching due to transposon insertion in unc-22. [(07/16/2018) NOTE: A user has reported their PCR and sequence analysis suggest this strain contains does not still contain Tc3, but retains loss unc-22 function, apparently due to imprecise excision.] |
| SX166 |
prg-1(n4357) I; prg-2(n4358) unc-22(st136) IV. |
Transposon silencing normal. |
| SX178 |
prg-1(n4357) I; unc-22(r765) IV. |
Twitching due to transposon insertion in unc-22. |
| SX278 |
prg-1(n4357) I; prg-2(n4358) unc-22(r765) IV. |
Transposon silencing normal. |
| SX494 |
prg-1(n4503) I; prg-2(nDf57) unc-22(r750) IV. |
Transposon silencing abnormal. Twitchers. |
| SX523 |
prg-1(n4357) I; prg-2(n4358) IV. |
21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Sterile at 25.5C; maintain at 20C or below. |
| SX9 |
prg-1(n4503) I; prg-2(nDf57) IV. |
Reduced brood size. Transposon silencing abnormal. Endogenous transposase levels increased. |
| SX922 |
prg-1(n4357) I. |
21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: GTTTTCTTTCCTTGGAGAGGT//GATGCTCATATTGTAATCT. |
| WM161 |
prg-1(tm872) I. |
Temperature sensitive. Sterile at 25C. Maintain at 20C or below. |
| WM274 |
prg-1(tm872) I; neSi14 II; unc-119(ed3) III. |
neSi14 [FLAG::prg-1 + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 (LG II). Reference: Lee HC, et al. Cell. 2012 Jul 6;150(1):78-87. |
| WM275 |
prg-1(tm872) I; neSi15 II; unc-119(ed3) III. |
neSi15 [FLAG::prg-1(D583A) + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 (LG II). Reference: Lee HC, et al. Cell. 2012 Jul 6;150(1):78-87. |