Gene Information: mir-228

Namemir-228 View on WormBase
Species C. elegans
SequenceT12E12.7
Genetic positionIV:1.85 +/- 0.005 cM
Genomic positionIV: 5562025..5562122

Strains carrying this gene

Strain Genotype Description
MT14446 mir-228(n4382) IV. Deletion breakpoints are: GTACACAGAACAATAGAAATCGCCT / CGTTTCTGTTT...CTACGATATTAT / GTCCGAATTAAATTGCTTTTTTTTTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.