Gene Information: mir-124
| Name | mir-124 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C29E6.7 |
| Genetic position | IV:5.35 +/- 0.004 cM |
| Genomic position | IV: 11871738..11871833 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| MT13292 | mir-124(n4255) IV. | Deletion breakpoints are:GTCGCTCATTGATTCACATCCATTTTGAG / AAGGATGGTT...GAATGCCACGTG / GCCATGATGGGGCTCCCATTGAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| SX620 | mir-124(n4255) IV; lin-15B&lin-15A(n765) X; mjIs27. | mjIs27 [mir-124p::GFP + lin-15(+)]. GFP expression in ~40 neurons, most of which are ciliated sensory neurons (AWC, AWA, AWB, ASH, ASI, ASK, PVQ (not ciliated), ASE, PHA, PHB, PVD (not ciliated), IL1, ADE, PDE). Reference: Clark AM, et al. Nucleic Acids Res. 2010 Jun;38(11):3780-93. |
| VT2527 | mir-124(n4255) IV. | Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15. |