Gene Information: mir-70

Namemir-70 View on WormBase
Species C. elegans
SequenceT10H9.7
Genetic positionV:0.13 +/- 0.000 cM
Genomic positionV: 6665536..6665635

Strains carrying this gene

Strain Genotype Description
MT12979 mir-70(n4110) V. Deletion breakpoints are:TTTTTTACCGTTGAGTTTCAGAAGT / ATATTTTTTCT...ACGACGTATTA / CATTTCTTCATAAGTGTTATTCGTCGAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT1362 mir-70(n4109) V. Deletion breakpoints are: ATTCATATTTCGATTAATAAAATTACCAAACA / CAATCCAACATAA...ATGGATACGCAGTA / AGAACAATATATGAACGATCGAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.