Gene Information: mir-259

Namemir-259 View on WormBase
Species C. elegans
SequenceF25D1.6
Genetic positionV:2.58 +/- 0.003 cM
Genomic positionV: 10539025..10539125

Strains carrying this gene

Strain Genotype Description
MT12969 mir-259(n4106) V. Deletion breakpoints are: GATTATAATGCAAACAACCTGGGGGATC / CAGTATCTTCA...AAGAGCGAAAGT / ACAGTCTCCTCCTTCTTTGCTCACTTCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT2905 mir-259(n4106) V; mir-34(gk437) X. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT2906 mir-83(n4638) IV; mir-259(n4106) V; mir-34(gk437) X. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3032 mir-83(n4638) IV; mir-259(n4106) V. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.