| MLC1384 |
mir-1(luc108) I. |
Superficially wild-type. CRISPR/Cas9-engineered mir-1 deletion allele (breakpoints: gcagaaaattactcaccattaaaacactaccacc |
| MT12954 |
mir-1(n4101) I. |
Deletion breakpoints are:TAGAGCATGTTGCCAATATTGGCAT / GAAAATATTGGCAA...TCACTTTGAATATAGCG / TAGATATAGAGTAGAATTGAATCTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| MT12955 |
mir-1(n4102) I. |
Deletion breakpoints are:CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| MT17810 |
mir-1(n4102) I. |
Deletion breakpoints are: CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| VC576 |
mir-1(gk276) I. |
T09B4.11. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |