| MLC903 |
nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X, lucIs24. |
lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Pick GFP+ animals to maintain balanced line. Balanced mir-51 family mutant expressing a mirtron-version of mir-51. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested nT1[qIs51] aneuploids, and non-GFP mir-51 family homozygous mutants. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Non-GFP mir-51 family homozygous mutants rescued by mirtron-51 transgene are viable, but slow-growing and sick. Strain is derived from injection into parental strain MT17143. lucIs24 is a spontaneous integrant originating from a complex extra-chromosomal array, the genomic location of the transgene is unknown. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press. |
| MT12945 |
mir-52(n4100) IV. |
Deletion breakpoints are: CTACTCCTACAACTACAACTAC / TACTACTACTATA...ATCACGTTTAAATCA / ATTTCCCAAGAGTTTTCGTATAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| MT12990 |
mir-52(n4114) IV. |
Deletion breakpoints are: CTTACCCCCCAAACCCTG / CCGCTACTACTACTACTCCTA...GAAAGGGTAGCCGGTTATT / GAAGTTGGGTCTTTTTTGGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| MT17143 |
nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X. |
Heterozygote. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Curr Bio (2010) 20:367-73. |
| MT17446 |
mir-53(n4113) mir-52(n4100) IV; nDf58 X. |
Slow growing. Some larval and adult lethality. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73. |