| BJS737 |
mpk-1(sbj10) III. |
Temperature sensitive allele of mpk-1, bypasses UV sensitivity of csb-1 mutant at 20-25C. Reference: Bianco JN & Schumacher B. Nucleic Acids Res. 2018 May 21. doi: 10.1093/nar/gky404. |
| DV3285 |
his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. |
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background.
C-terminally tagged mpk-1 is detectable by triplex PCR:
mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG
mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC
mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC
Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development. |
| MH37 |
mpk-1(ku1) unc-32(e189) III. |
Unc. ku1 pka sur-1(ku1). |
| MT8186 |
mpk-1(oz140)/dpy-17(e164) unc-79(e1068) III. |
Heterozygotes are WT and segregate WT, Vul and DpyUncs. oz140 homozygotes are Vul and Sterile. |
| MT8388 |
dpy-17(e164) mpk-1(oz140)/dpy-17(e164) unc-79(e1068) III. |
Heterozygotes are Dpy and segregate Dpy, DpyUncs and DpyVulSterile. oz140 homozygotes are Vul and Sterile. |
| NL723 |
mpk-1(pk79) mut-2(r459) I. |
|
| PJ1109 |
mpk-1(n2521) III; let-60(ga89) IV; ccIs55 V. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. |
| PJ1114 |
clr-1(e1745) II; mpk-1(n2521) III; ccIs55 V. |
ccIs55 [unc-54::lacZ + sup-7(st5)] V. clr-1 is termperature-sensitive. |
| SD184 |
unc-79(e1068) mpk-1(n2521) III. |
Unc. |
| SD366 |
mpk-1(n2521) III; let-60(n1046) IV. |
Less than 5% Muv animals. |
| SD378 |
mpk-1(ga117)/dpy-17(e164) unc-79(e1068) III. |
Heterozygotes are WT and segregate WT, Sterile Vuls, and Dpy Uncs. |
| SD415 |
mpk-1(ga118)/dpy-17(e164) unc-79(e1068) III. |
Heterozygotes are WT and segregate WT, Sterile Vuls, and Dpy Uncs. |
| SD420 |
mpk-1(ga119)/dpy-17(e164) unc-79(e1068) III. |
Heterozygotes are WT and segregate WT, Sterile Vuls, and Dpy Uncs. |
| SD939 |
mpk-1(ga111) unc-79(e1068) III. |
Unc. Temperature-sensitive sterile. Maintain at 15C. NOTE: Lackenr & Kim (1998) incorrectly states that the ga111 mutant has a T to C transition. The transition is actually T to G giving rise to a Val148Gly substitution. Reference: Lackner MR & Kim SK. Genetics. 1998 Sep;150(1):103-17. |