Gene Information: mix-1

Namemix-1 View on WormBase
Species C. elegans
SequenceM106.1
Genetic positionII:3.13 +/- 0.001 cM
Genomic positionII: 10824246..10841424

Strains carrying this gene

Strain Genotype Description
KK96 unc-4(e120) mix-1(b285) sqt-1(sc13)/mnC1 [dpy-10(e128) unc-52(e444)] II. mix-1(b285) is maternal effect lethal. Heterozygotes are WT and segregate WT, Unc-4 worms which are strong Egl, and paralyzed Dpy Uncs.
SP365 unc-4(e120) mix-1(mn29)/mnC1 [dpy-10(e128) unc-52(e444)] II. Hets are WT and segregate WT, paralysed DpyUnc and late larval Unc-4. Maintain by picking WT. mn29 pka let-29(mn29). See also WBPaper00002999.
VC10079 unc-4(e120) mix-1(gk803) II. M106.1. Unc. External left primer: GTTGAGGAAGCAGCTGGAAC. External right primer: TTCTTCGCAGCAGTAATCCC. External WT amplicon: 815 bp. This strain carries a point mutation in M106.1. The mutation is gk803, which is an A->G mutation at R06F6 coordinate 40587 (flanking sequences CACAAAATACCGTAATGACCTCGAATCCCT and ACGAGAGGAACAATTGCTAATGACAAAGGA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807