| JK1521 |
fog-2(q71) pha-4(q490)/stu-3(q265) rol-9(sc148) V. |
Heterozygotes are WT and segregate WT, Females which lack a pharynx (arrest as embryos or L1) and Sterile Unc Rollers. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. See also WBPaper00003770. |
| OH15876 |
pha-4(ot946[pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]) V. |
GFP tag inserted at the C-terminus of the endogenous pha-4 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. Please contact Oliver Hobert prior to publishing work using this strain. |
| RW12220 |
pha-4(st12220[pha-4::TY1::EGFP::3xFLAG]) V. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| SM190 |
smg-1(cc546) I; pha-4(zu225) V. |
Dies at 15-20C with mostly dead embyros and a few dead larvae. Grows best at 24C. Survives at 25C, but worms look sick (often small and clear) and have very reduced brood sizes. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] |