Gene Information: mog-4

Namemog-4 View on WormBase
Species C. elegans
SequenceC04H5.6
Genetic positionII:23.12 +/- 0.004 cM
Genomic positionII: 14552504..14561599

Strains carrying this gene

Strain Genotype Description
JK907 mog-4(q233)/mnC1 [dpy-10(e128) unc-52(e444)] II. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VC2127 mog-4(ok2708)/mT1 II; +/mT1 [dpy-10(e128)] III. C04H5.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2708 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCTTCGCCTGCAAATCAC. External right primer: TTCATGCCGTACCTGTTCAA. Internal left primer: TCTTCGATCCCAGTGCTTTC. Internal right primer: AAGGAGCAAAACTTCGATGG. Internal WT amplicon: 3202 bp. Deletion size: 2453 bp. Deletion left flank: ATACCAAAATATCGCCGGGAAGTGGCTGGG. Deletion right flank: GCGAATAAAAGTCGAAAAAAAAATGTTTTG. Insertion Sequence: ATTTTTTTTCGTTTTTTTTTGGGTTTATTCGAAGTATTGATTAAAATTTAAGAGCGATC GATTTTTTTCTTAATTAAAAACAAAAATCCTGAATGTTTGGTTTTTTTGCTGTTTTTGT AAATGTTCTAAAAATTACCTATAACTAGCCAAATCGGGTTCGTTGAGAAACTCTCTGAG CAGCATTCCGTCTGTCATGTATTTGAGGACAGTCTTCTCCGATGTGCAATCCTCGAAAC GAATACTGTAGCCGACCTGGAAAATGGAAGCGTTTCGAAAGAAAAATCGGAATCTGTTT TCCTCGTTTTTTTACAAGTTTAAAAATTTTTAGAAGCGGCAAAGAATTGCCCAAATTTT TTTAACTTCCAGTTTTTTTTTCTAAATTTTGGAATTTTCCGACTAGAATGAAACTTAGT TTATTTTCGCCAATTTCCAAAAACCACCCAACCTGAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807