Caenorhabditis Genetics Center (CGC)

Gene Information: hyl-2

Namehyl-2 View on WormBase
Species C. elegans
SequenceK02G10.6
Genetic positionX:-6.90 +/- 0.008 cM
Genomic positionX: 4696754..4699461

Strains carrying this gene

Strain Genotype Description
JCM1 hyl-2(gnv1) X. gnv1 was found in strain AT10. hyl-2(+):CATCAT: aagcgcagtgatttctggcaaatgcttgttcatcattttatcaccctcgcacttattgg tgtttca; hyl-2(gnv1): CAATAT: aagcgcagtgatttctggcaaatgcttgttcaatattttatcaccctcgcacttattgg tgtttca. Anoxia sensitive. Heat-shock (36 deg Celcius) sensitive.
RB1498 hyl-2(ok1766) X. K02G10.6 Homozygous. Outer Left Sequence: acgcagtttccaagcatttc. Outer Right Sequence: tccttttcctcctcggtttt. Inner Left Sequence: gggggagtgatggaagaaat. Inner Right Sequence: ttgcaaaccaattgcaagaa. Inner Primer PCR Length: 3075. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807