| GR1373 |
eri-1(mg366) IV. |
Temperature sensitive: sterile at 25C. Maintain at 15C. Him. Eri. Due to a direct repeat the exact site and sequence of the 23 bp eri-1(mg366) insertion is unclear, however, the insertion lies in exon 6 of T07A9 between nucleotide positions 35215 and 35204 of cosmid T07A9 and includes 23 or these 32 nucleotides tttatcgaaaaaaaaacaggcactttatcgaa. Primers to follow eri-1mg366: GATAAAACTTCGGAACATATGGGGC and ACTGATGGGTAAGGAATCGAAGACG. These primers will give a 170 bp product in N2 and a 193 bp product in eri-1(mg366). |
| GR1379 |
lin-35(n745) I; eri-1(mg366) IV. |
Temperature sensitive sterile at 25C. Maintain at 15C. |
| KP3948 |
eri-1(mg366) IV; lin-15B(n744) X. |
Enhanced RNAi. Temperature sensitive sterile at 25C. Grow at 15 to 20C. |
| NL3630 |
pkIs32 III; eri-1(mg366) IV. |
pkIs32[pie-1::GFP::H2B]. RNAi hypersensitive. |
| RB2025 |
eri-1(ok2683) IV. |
T07A9.5. Homozygous. Outer Left Sequence: CCAAAGAACTTCCATCTGCC. Outer Right Sequence: TGCGGGTCATCACTAATCCT. Inner Left Sequence: TTTCGATAGGATGACGAAACG. Inner Right Sequence: GGGCTTTAACACAATTCTCCC. Inner Primer PCR Length: 1218 bp. Deletion Size: 811 bp. Deletion left flank: CCCGGAAAAAATGATTTTCTTGCGGGAAAA. Deletion right flank: TTTTCAGATTCGTCGGTTCTGGTTTCAGCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| XE1057 |
eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. |
Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921. |
| XE1375 |
wpIs36 I; wpSi1 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. |
wpIs36 [unc-47p::mCherry] I. wpSi1 [unc-47p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. GABAergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the GABAergic neurons; all other tissues are resistant to RNAi. Superficially wild type with mCherry fluorescence in the GABA motor neurons. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921. |
| XE1474 |
wpSi6 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. |
wpSi6 [dat-1p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Dopaminergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the dopaminergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921. |
| XE1581 |
wpSi10 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. |
wpSi10 [unc-17p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Cholinergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the cholinergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921. |
| XE1582 |
wpSi11 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. |
wpSi11 [eat-4p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Glutamatergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the glutamatergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921. |