| DQM311 |
hlh-2(bmd90[LoxP::GFP::hlh-2]) I. |
GFP reporter inserted into N-terminus of endogenous hlh-2 locus. Reference: Medwig-Kinney TN, et al. Development. 2020 Jan 2;147(1). |
| EM496 |
hlh-2(bx108) I; him-5(e1490) V; lin-32(e1926) X. |
Males are rayless. hlh-2(bx108) strongly and semi-dominantly enhances the ray-loss phenotype of lin-32(e1926). |
| EM598 |
hlh-2(bx115) unc-13(e51) I; him-5(e1490) V. |
Paralyzed Unc. Throws males. hlh-2(bx115) has no phenotype in this background. |
| GS8949 |
hlh-2(ar623[gfp::hlh-2]) I. |
GFP tag inserted into endogenous hlh-2 locus produces a fully-functional GFP-tagged form of HLH-2. Reference: Attner et al., 2019, Current Biology 29, 1-7. |
| JK4099 |
hlh-2(tm1768) I. |
Temperature sensitive sterile. Partially sterile at 20 C; completely sterile at 25 C. Maintain at <20 C. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| MT19085 |
hlh-2(n5287) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n5287 homozygotes (embryonic lethal). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. n5287 is a 2,694 bp deletion (flanking seq 5' - TGCAACTGCCGCCATTGCTC 3' - AAAACTCTCTAGCATATTGT) and 25 bp insertion (TCTGCCATCATTGCTGCCATTGCTC). Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27. |