Gene Information: hlh-2

Namehlh-2 View on WormBase
Species C. elegans
SequenceM05B5.5
Genetic positionI:1.83 +/- 0.002 cM
Genomic positionI: 7190788..7193920

Strains carrying this gene

Strain Genotype Description
DQM311 hlh-2(bmd90[LoxP::GFP::hlh-2]) I. GFP reporter inserted into N-terminus of endogenous hlh-2 locus. Reference: Medwig-Kinney TN, et al. Development. 2020 Jan 2;147(1).
EM496 hlh-2(bx108) I; him-5(e1490) V; lin-32(e1926) X. Males are rayless. hlh-2(bx108) strongly and semi-dominantly enhances the ray-loss phenotype of lin-32(e1926).
EM598 hlh-2(bx115) unc-13(e51) I; him-5(e1490) V. Paralyzed Unc. Throws males. hlh-2(bx115) has no phenotype in this background.
GS8949 hlh-2(ar623[gfp::hlh-2]) I. GFP tag inserted into endogenous hlh-2 locus produces a fully-functional GFP-tagged form of HLH-2. Reference: Attner et al., 2019, Current Biology 29, 1-7.
JK4099 hlh-2(tm1768) I. Temperature sensitive sterile. Partially sterile at 20 C; completely sterile at 25 C. Maintain at <20 C. Do not distribute this strain; other labs should request it directly from the CGC.
MT19085 hlh-2(n5287) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n5287 homozygotes (embryonic lethal). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. n5287 is a 2,694 bp deletion (flanking seq 5' - TGCAACTGCCGCCATTGCTC 3' - AAAACTCTCTAGCATATTGT) and 25 bp insertion (TCTGCCATCATTGCTGCCATTGCTC). Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27.