| DW102 |
brc-1(tm1145) III. |
Homozygous viable. Weak Him phenotype (2-3%). Extremely sensitive to ionizing radiation and other DNA damaging agents. |
| NB390 |
hsr-9(ok759) I; brc-1(tm1145) III. |
Reduced apoptosis after gamma-ray treatment compared to N2. Double mutant exhibits hypersensitivity to gamma rays similar to brc-1(tm1145) alone. Reference: Ryu JS, et al; PLoS One. (In Press). |
| RB1209 |
brc-1(ok1261) III. |
C36A4.8 Homozygous. Outer Left Sequence: aagccaatgaactggtggtc. Outer Right Sequence: tttgtgtgcaaacaccgatt. Inner Left Sequence: gttgagaccgcagaaatcgt. Inner Right Sequence: caaaccgacacaaaatcacg. Inner Primer PCR Length: 2392. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC4248 |
brc-1(gk5332[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. |
Homozygous viable. Deletion of 9229 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CATTTTTATTTGAATTTTAGGCACTTAATT; Right flanking sequence: AGGATACTCTTCGATTCGCTGGTTTCTCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |