Gene Information: daf-14

Namedaf-14 View on WormBase
Species C. elegans
SequenceF01G10.8
Genetic positionIV:4.56 +/- 0.000 cM
Genomic positionIV: 10250627..10255852

Strains carrying this gene

Strain Genotype Description
DR201 dpy-13(e184) daf-14(m77) IV. Temperature sensitive dauer constitutive. Dpy. Leaky double at 25C.
DR202 unc-24(e138) daf-14(m77) IV. Temperature sensitive dauer constitutive. Unc.
DR245 daf-14(m77) unc-22(m52) IV. Temperature sensitive dauer constitutive. Dominant Twitcher
DR442 unc-8(e49) daf-14(m77) IV. Temperature sensitive dauer constitutive. Unc.
DR77 daf-14(m77) IV. Temperature sensitive dauer constitutive. Tight at 25C. Leaky at 15C. Chemotaxis normal.
JJ938 unc-24(e138) daf-14(m77)/elt-1(zu180) dpy-20(e1282) IV. At 20C or 25C, heterozygotes are WT and segregate WT, UncDaf and dead eggs. At 15C, heterozygotes are WT and segregate WT, Uncs and dead eggs.
JT10189 daf-14(m77) IV; scd-2(sa935) V. Daf-c strongly but not completely suppressed; some dauers visible at 25C. sa935 alone is moderate Daf-d (dauer defective) in plate starvation assays, and resistant to exogenous dauer pheromone. sa935 confers strong suppression of daf-8 and daf-14, weak suppression of daf-1, -4, -7. scd-2(sa935) single mutant looks WT. snb-1(md247) hypomorph is an excellent balancer for scd-2; snb-1 is immediately neighboring. Maintain at 15 degrees.
PJ1194 daf-14(m77) IV; ccIs55 V. ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Temperature-sensitive; constitutive dauer formation at 25C.
PJ1276 daf-8(e1393) I; daf-14(m77) IV; ccIs55 V. ccIs55 [unc-54::lacZ + sup-7(st5)] V. Temperature-sensitive. Some dauer formation at 16C.
RB2620 daf-14(ok3647) IV. F01G10.8 Homozygous. Outer Left Sequence:ccaaccgacttccttgttgt . Outer Right Sequence: attcgttcatcagccacctc. Inner Left Sequence: ggctgcggggaattatatgt. Inner Right Sequence: tccgagagccaatgttttct. Inner Primer PCR Length: 1192. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807