Gene Information: unc-112

Nameunc-112 View on WormBase
Species C. elegans
SequenceC47E8.7
Genetic positionV:6.70 +/- 0.007 cM
Genomic positionV: 14691855..14696654

Strains carrying this gene

Strain Genotype Description
DM1208 unc-112(r367ra202) V. Intragenic revertant (ra202) of original unc-112 mutation. WBPaper 00005804.
DM1245 unc-112(r367) V; Y102F5A.1(ra238) dim-1(ra204) X. Y102F5A.1. Deletion extents determined by oligo array CGH. Deletion size: ~14kb. Deletion left flank: GGCAATCCTGGCCGAAGCTTTGAAACGCCCGAGTAAAGCCAAGAAGCGTC. Deletion right flank: GTTGTCTTTATCGAACCGCGTTGTTGAACTGTTGCATGAATCATGATTTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.
DM3004 unc-112(r367) V; raDf4/+ X. The unc-112(r367); raDf4/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf4 homozygotes arrest as L2 larvae. raDf4 deletes dim-1.
DM3006 unc-112(r367) V; raDf6/+ X. The unc-112(r367); raDf6/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf6 homozygotes arrest during embryogenesis. raDf6 deletes dim-1.
DM3007 unc-112(r367) V; +/raDf7 X. raDf7 suppresses the paralyzed phenotype of unc-112(r367) because the deficiency deletes the dim-1 gene. Reduction or loss of the dim-1 gene product suppresses the unc-112(r367) phenotype. In this strain: Animals homozygous for raDf7 arrest as L1 or L2 larvae; Animals without raDf7 are paralyzed as adults; Animals heterozygous for raDf7 move reasonably well.
DM3009 unc-112(r367) V; raDf9/+ X. The unc-112(r367); raDf9/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf9 homozygotes arrest as L1 or L2 larvae. raDf9 deletes dim-1.
DM3010 unc-112(r367) V; raDf10/+ X. The unc-112(r367); raDf10/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf10 homozygotes arrest as L1 or L2 larvae. raDf10 deletes dim-1.
DM3011 unc-112(r367) V; raDf11/+ X. The unc-112(r367); raDf11/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf11 homozygotes arrest as L1 or L2 larvae. raDf11 deletes dim-1.
DM3012 unc-112(r367) V; raDf12/+ X. The unc-112(r367); raDf12/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf12 homozygotes arrest as L1 or L2 larvae. raDf12 deletes dim-1.
DM5113 unc-112(r367) V; raEx11. raEx11 [(pDM#208) unc-112(+) + rol-6(su1006)]. Maintain by picking Rollers. raEx11 rescues the r367 phenotype. Segregates Unc-112 and Rollers.
DM5115 unc-112(st581) V; raEx16. raEx16 [unc-112::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. raEx16 produces a fully functional GFP-tagged unc-112 protein that localizes to the dense bodies and M-line in muscle cells, and rescues the lethal phenotype of unc-112(st581) homozygous animals. Reference: Rogalski TM, et al. J Cell Biol. 2000 Jul 10;150(1):253-64.
DM5116 unc-112(gk1)/unc-39(e257) V. C47E8.7. Heterozygotes are WT and segregate WT, Pat unc-112 homozygotes and Unc homozygotes. Pick WT to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RW3570 unc-112(st562)/dpy-11(e224) unc-23(e25) V. Heterozygotes are WT and segregate WT, DpyUnc and Pats. Maintain by picking WT and checking for correction segregation of progeny.
RW3609 unc-112(st581)/unc-39(e257) V. Heterozgyotes are WT and segregate WT, Unc and Pats. Maintain by picking WT and checking for correct segregation of progeny.
VC100 unc-112(r367) V; gkDf2 X. gkDf2. Multiple genes deleted. Deletion extents determined by oligo array CGH. Deletion size: ~44kb. Deletion left flank: TTAGTAAGCCGGAAAATGGATTTCGCTTTTCTCCTATTGAGAAACCTAAA. Deletion right flank: CTACCTTTCAAAATGAATAGCAACCACTTTTTCGACGAAGAAATGTTCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC54 unc-112(r367) V; dim-1(gk54) X. C18A11.7. Suppressed Unc. Left primer: TCCACCAACAAGCTTTTGCC. Right primer: CTCAGTCGATCACAATACAG. WT amplicon: 1031 bp. Deletion size: 133 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807