Gene Information: unc-101

Nameunc-101 View on WormBase
Species C. elegans
SequenceK11D2.3
Genetic positionI:13.31 +/- 0.032 cM
Genomic positionI: 12508299..12513420

Strains carrying this gene

Strain Genotype Description
ATD6 par-6(zu222) unc-101(m1)/hIn1[unc-54(h1040)] I; unc-119(ed3) III; zuIs45 V. zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Balanced worms are wild-type and segregate wild-type (heterozygotes), Coil Par (par-6 unc-101 homozygotes; maternal effect lethal), and paralyzed Unc (hIn1 homozygotes). Par phenotype is slightly leaky, but survivors are agametic. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and KK818. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
DA501 unc-101(m1) unc-59(e261) I.
DA502 unc-75(e950) unc-101(m1) I. Unc. Eat.
DA729 unc-101(m1) eat-9(e2337) I. Unc. Abnormal feeding. Irregular pumping.
DA734 adDf538 unc-101(m1) I. Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. Unc. adDf538 previously called phm-2(ad538).
DR1 unc-101(m1) I. Paralyzed coiler. Slightly Egl. Slightly short. About half do not survive to adulthood-arrest usually in L1. See also WBPaper00001868.
DR293 dpy-5(e61) unc-101(m1) I. Dpy. Unc-paralyzed coiler.
FT36 unc-101(m1) par-6(zu170) I; zuIs43. zuIs43[pie-1::GFP::PAR-6::ZF1 + unc-119(+)]. Unc worms. GFP present in early embryos but then degrades in somatic lineages. Rescues Mel phenotype of par-6(zu170).
HR899 unc-101(m1) tba-2(sb25) I. Unc.
HR973 unc-101(m1) tba-2(sb27) I. Unc.
JJ1578 par-6(zu222) unc-101(m1); zuIs54. zuIs54 [par-6p::par-6::ZF1::GFP + unc-119(+)]. Unc. GFP-tagged PAR-6 that degrades in early embryonic somatic cells; rescues the Par phenotype of par-6(zu222). Delayed gastrulation of endodermal cells. Reference: Nance J, Munro EM, Priess JR. Development. 2003 Nov;130(22):5339-50.
KK818 par-6(zu222) unc-101(m1)/hIn1 [unc-54(h1040)] I. Heterozygotes are WT and segregate WT, paralyzed Unc, and Coilers which give only dead eggs (slightly leaky, but survivors are agametic). zu222 is a strict maternal effect embryonic lethal. Partitioning defect similar to that of par-3; fails to localize PAR-3 protein.
KR2405 eDf3/hIn1 [unc-101(sy241)] I. Wild type, segregating unc-101, wild type and arrested embryos. eDf3 homozygote arrests as unhatched embryo at lima bean stage. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. [4/98: Paul Mains tested eDf3 in this strain with unc-54 and unc-59. Both resulted in complementation; therefore, there may be a problem with eDf3 in this strain.]
KR2406 eDf4/hIn1 [unc-101(sy241)] I. Wild type, segregating Unc-101 (hIn1[unc-101] homozygotes), wild type and arrested embryos. eDf4 homozygote arrests as unhatched embryo at lima bean stage. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR2407 eDf6/hIn1 [unc-101(sy241)] I. Wild type, segregating Unc-101 (hIn1[unc-101] homozygotes), wild type and arrested embryos. eDf6 homozygote arrests as unhatched embryo at lima bean stage. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR2432 eDf13/hIn1 [unc-101(sy241)] I. Wild-type segregating wild-type, Unc-101 (hIn1[unc-101] homozygotes) and arrested crescent-shaped larvae (eDf13 homozygotes, probably L1). Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR2433 eDf14/hIn1 [unc-101(sy241)] I. Wild-type segregating wild-type, Unc-101 (hIn1[unc-101] homozygotes) and arrested crescent-shaped larvae (eDf14 homozygotes, probably L1). Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
ML653 vab-10(mc44)/unc-75(e950) unc-101(m1) I. Heterozygotes are WT and segregate WT, Uncs and dead eggs and larvae with severe body morphology defects that do not develop beyond the L2 stage. A few very rare mc44 larvae reach adulthood but they become sterile. mc 44 is a deletion affecting the downstream transcription unit of vab-10 named vab-10b. Fails to complement the vab-10 null reference allele vab-10(h1356), but complements the vab-10a alleles vab-10a(e698) and vab-10a(ju281).
ML691 vab-10(ok817)/unc-75(e950) unc-101(m1) I. Heterozygotes are WT and segregate WT, Uncs, and severely Lumpy arrested L1s (ok817). m1 can easily get lost through recombination.
MT19851 sptf-3(tm607)/hIn1 [unc-101(sy241)] nIs425 I; nIs175 IV. nIs425 [myo-2p::GFP] I. nIs175 [ceh-28p::4NLS::GFP + lin-15(+)] IV. Heterozygotes are GFP+ wild type and segregate GFP+ Unc, GFP+ wild type, and GFP- sptf-3 homozygotes. nIs425 was integrated into sptf-3(tm607)/hIn1[unc-101(sy241)] I. The position of integration appears to be close to or lie within the region covered by hIn1: sptf-3(tm607) heterozygotes are GFP+ whereas sptf-3(tm607) homozygotes do not express GFP in the pharynx. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
OH7116 lsy-22(ot114) unc-101(m1) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); otIs3 V. otIs3 [gcy-7::GFP + lin-15(+)]. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. Heterozygotes are WT and GFP+. Homozygous lsy-22(ot114) unc-101(m1) animals are Unc and have a maternal effect embryonic lethal phenotype. Whole genome sequenced strain.
PS1009 unc-101(sy237) I; sli-1(sy143) X. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1056 hIn1 [unc-101(sy241)] I. Unc. Previously described as hC1 (hC1 also known as hIn1). This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS529 unc-101(sy108) I. Unc. Suppresses the Vul phenotypes of let-23(lf) mutants. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS632 unc-101(sy161) I; let-23(sy1) II. Grows slowly with low brood numbers. Sluggish worms. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS968 unc-101(sy216)/hIn1 [unc-54(h1040)] I. Heterozygotes are WT and segregate embryonic lethals (sy216 homozygotes) and paralyzed Uncs (h1040 homozygotes). sy216 is a deletion of the unc-101 gene region. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
SL536 dxDf2/spe-9(eb19) unc-101(m1) I. Heterozygotes are Unc and segregate Uncs, Sterile Uncs and dead eggs. Strain is sick and grows slowly. dxDf2 fails to complement unc-54, so it could delete the entire right arm of LG I.
VC1259 K05C4.2&K05C4.11(ok1713)/hIn1 [unc-101(sy241)] I. K05C4.11, K05C4.2. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok1713 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGGAAGACGAATCTTTTCGG. External right primer: AAGGACCACCGTCTTCAATG. Internal left primer: ATTAAAGGTGGCCGGAGATT. Internal right primer: GTGGAGGGTCTGATTGGAGA. Internal WT amplicon: 3304 bp. Deletion size: 810 bp. Deletion left flank: AGTCCGTCCCATCGGTACCCGCCGCTCGAA. Deletion right flank: TTTTTAGATCTTGGATTTTACTGGAAAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1286 Y6B3A.1(ok1736)/hIn1 [unc-101(sy241)] I. Y6B3A.1. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok1736 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTTTCACGACGATTTTGGC. External right primer: CAGAGCGACGAAACAAGTGA. Internal left primer: CAACGCTGCGAGAATATCAA. Internal right primer: ACAATGGGTGAAAGTGAGGC. Internal WT amplicon: 2907 bp. Deletion size: 1645 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1630 Y54E5A.2(ok2070)/hIn1 [unc-101(sy241)] I. Y54E5A.2. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2070 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGTTTCGGTGTTGAGAGCGT. External right primer: TGGTGCATGATTTGTGGATT. Internal left primer: GCTCACAACTTCACGCAGAG. Internal right primer: TAAACACCAAGTGGCACCAA. Internal WT amplicon: 2168 bp. Deletion size: 1739 bp. Deletion left flank: AATTTCACGGGGTATATTTAATTTTTAATT. Deletion right flank: TTTTATCATGATATCTCAAAAGTTGAGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1780 vps-28(ok2278)/hIn1 [unc-101(sy241)] I. Y87G2A.10. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2278 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAGACGTTGTGTCTTCCCG. External right primer: CTACAAACCGAGCTGAGCCT. Internal left primer: CCTCACAATTTTGAAACTGCTC. Internal right primer: AATTTCGAGTTTTCGCTTGAA. Internal WT amplicon: 3080 bp. Deletion size: approximately 1600 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1931 K03D10.3(ok2429)/hIn1 [unc-101(sy241)] I. K03D10.3. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2429 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACTGTTTGAACTCACCCCG. External right primer: AAATTTCCGGTTTTCTGGCT. Internal left primer: TAAAAATTGGGTGAGGCTCG. Internal right primer: TACGGGAAAAACTGCCAAAA. Internal WT amplicon: 3157 bp. Deletion size: 2168 bp. Deletion left flank: AACTGTAATTTACGGTGTTTTATATCGAAT. Deletion right flank: GCATTTAAATCGATTTTTCCCATAAAATCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2011 Y48G10A.3(ok2508)/hIn1 [unc-101(sy241)] I. Y48G10A.3. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGGATGGTTTTCGCAGTTT. External right primer: TGACATGCAGCCTCTAATGG. Internal left primer: ATTCTGCGTCTCCTGCATCT. Internal right primer: AAAAGTGAACACGGCCTTTG. Internal WT amplicon: 2246 bp. Deletion size: 1628 bp. Deletion left flank: AAAAGAGCATCATGCTCTCCGTCACAGCGT. Deletion right flank: TTTTAAAAAAGTTTTGGTTTTTTTTTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2125 tfg-1(ok2290)/hIn1 [unc-101(sy241)] I. Y63D3A.5. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2290 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGCTCCGGATAAACTTGGGT. External right primer: TATTCCCTTCCCACCAATCA. Internal left primer: TTCCAGATGGTGCATTCAAA. Internal right primer: AGACAGGAGCCCGAGATTTT. Internal WT amplicon: 2440 bp. Deletion size: 1264 bp. Deletion left flank: AGCAGATTAAGGTAAGGAGGATTTTGAGCG. Deletion right flank: CCACCACCGCAGGGAGCTCCCCAGCAAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2275 uev-1(ok2597)/hIn1 [unc-101(sy241)] I. F39B2.2. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2597 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAATGCGTACTCGCACTGA. External right primer: GGAAAAGTTCGAGGGGAAAG. Internal left primer: ACGGATTTATTCGGATGGGT. Internal right primer: TACCGGGGAGAGTAAACTGG. Internal WT amplicon: 1302 bp. Deletion size: 727 bp. Deletion left flank: TTATGGTAACACTTTGTGGCGGGACCAATC. Deletion right flank: ATGTACCACGCAATTTCCGTCTGCTGGAAG. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2290 W09C5.8(ok2908)/hIn1 [unc-101(sy241)] I. W09C5.8. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2908 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCTCGCTACTACCCGCTA. External right primer: CCCGTGTGTTCTGTTGTTTG. Internal left primer: CAGCCCATCTCTCAAGAAGC. Internal right primer: TCCTCTTCCACGTTTCCATC. Internal WT amplicon: 1106 bp. Deletion size: 565 bp. Deletion left flank: CCTTCTCGAGCACAAGCGCACGCTCAACCT. Deletion right flank: AATAAATAACTGGTTTATGGGTTGAAAATG. Insertion Sequence: CAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2334 K11D2.5(ok3030)/hIn1 [unc-101(sy241)] I. K11D2.5. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3030 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTTGGCAAATTTTTGATGGC. External right primer: ATTTTCCGCTCGGAATTTTT. Internal left primer: TCTTTCGTGCTTCCAGCTTC. Internal right primer: TTTCTCGTTGATTTTCCCCA. Internal WT amplicon: 1208 bp. Deletion size: 605 bp. Deletion left flank: ATTGGTGGATTTTTCTCCAGAAAGCAGGTG. Deletion right flank: TTCAAAATTTTAGGTCTTGAAATTTCTAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2634 pbs-5(ok3318)/hIn1 [unc-101(sy241)] I. K05C4.1. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3318 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGAATCACTCGACTGGGTTG. External right primer: TCCAGATTCACGGATTCTCC. Internal left primer: TATCTCTGCCGAGCTCATCG. Internal right primer: CAATTTTCCCCCATTTGTTG. Internal WT amplicon: 1314 bp. Deletion size: 725 bp. Deletion left flank: ATATCTCTGCCGAGCTCATCGGCAAACTCG. Deletion right flank: ATCTCCGATGTCCAAGATCTTCATGACCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2803 rpl-31(ok3358)/hIn1 [unc-101(sy241)] I. W09C5.6. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3358 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ACGTTACCATCAAGGCTCCA. External right primer: ATCGTCCCGTTTTGTGAGTC. Internal left primer: CTTCTGTTCTCCCCCAACCT. Internal right primer: TGCAAGTATGCTCCGTTGAA. Internal WT amplicon: 1101 bp. Deletion size: 640 bp. Deletion left flank: GACGGACACGAACTCTGTATGGAACGTTCT. Deletion right flank: AGTAGGAGCTTTATTTCAGAGAGAAAACAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2896 F32A7.4(ok3586)/hIn1 [unc-101(sy241)] I. F32A7.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3586 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTGTGCGTTATTTCGGAGC. External right primer: CTTTCATCCGTCATTGCTCA. Internal left primer: GACTATTTCTTCGACATTTTATTGC. Internal right primer: GGGTAGATTTTGAAAAAGAAACG. Internal WT amplicon: 1238 bp. Deletion size: 539 bp. Deletion left flank: ATTTGAGGTAAACGAAAAAATAATATAAAA. Deletion right flank: GGCAAGATTAGCCCCAAACTATGCAGAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2897 gpi-1(ok3599)/hIn1 [unc-101(sy241)] I. Y87G2A.8. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3599 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGTCTGAGCCTCAACCAAAA. External right primer: CTCTCACTCAAAATGCGGGT. Internal left primer: CAGAATTTTGAGAAAATCCAACG. Internal right primer: AGTTTGTAGCCCCTCAGCCT. Internal WT amplicon: 1205 bp. Deletion size: 621 bp. Deletion left flank: ACCAAATCGGACCGAATGTGCACTTCGTGT. Deletion right flank: ATCAGTTGATTCATCAGGGTACTCGACTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3071 hsf-1(ok600)/hIn1 [unc-101(sy241)] I. Y53C10A.12. Replaces strain VC358. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok600 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAAACAACAAATCCTCGGCT. External right primer: GCTCAATGCGTCAACAACAT. Internal left primer: GTGGATGAGGTGGAAGTCGT. Internal right primer: GTCGCGAAACGGTAATCAAT. Internal WT amplicon: 2605 bp. Deletion size: 877 bp. Deletion left flank: ATGAGTCAATGGACCGGATCCCATGTACAT. Deletion right flank: TTCTAAGAAATTTTTATTTTCTGAAAAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3209 Y48G10A.4(gk3088)/hIn1 [unc-101(sy241)] I. Y48G10A.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and gk3088 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTAATTGTTCGGCGAATTTT. External right primer: AAACATTTTCAACCCTGCAAGT. Internal left primer: ATACGTCACCCGAGCAATTC. Internal right primer: CAACCAGAATGCAGAGCAAA. Internal WT amplicon: 1226 bp. Deletion size: 763 bp. Deletion left flank: CCAGTATAGATTGAATAACTTTAAAAATTT. Deletion right flank: AAAATGCTCCACGTACGCATTCTCATGATT. Insertion Sequence: AACTATAGTTATTTAAATTCTTACTGTAGTTTTCGCTAAGTGATATCGCGCGTCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3221 C01A2.5(gk3070)/hIn1 [unc-101(sy241)] I. C01A2.5. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and gk3070 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TAAATATAATACCGTGCGTGCG. External right primer: TCAAAGTCATGTTTCCGTATCG. Internal left primer: GGCTCAGGGTAAATAGACATGG. Internal right primer: TTTAAATGGGTTTGAATCTGGG. Internal WT amplicon: 1458 bp. Deletion size: 510 bp. Deletion left flank: ATTGCAAAAGTGGGCGGGGCGTCGTTTCGT. Deletion right flank: ATCAACTCGATTTTGAGCAAAACTATCTCG. Insertion Sequence: TAGTTATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC353 snr-2(gk209)/hIn1 [unc-101(sy241)] I. W08E3.1. Heterozygotes are WT and segregate WT, Unc hIn1 homozygotes and gk209 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3986 Y18D10A.9(gk5013[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hIn1[unc-101(sy241)] I . Recessive lethal deletion balanced by hIn1. Deletion of 4986 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAAATTTCGGATTCGGGTTCCATGCCA; Right flanking sequence: GTCTGAAAATTGAAAATAAATTTAAAAACT. See WormBase Variation gk5013 for details.
VC4475 W04A8.6(gk5429[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hIn1[unc-101(sy241)] I. Apparent homozygous lethal or sterile deletion balanced by hIn1[unc-101]. Pick viable fertile GFP+ animals to maintain; hIn1 homozygotes are non-GFP Unc. Deletion of 3831 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAAGTCGAATTTTTAGCCAAAAACCTTAG. Right flanking sequence: GCCGCTCAAATTGCGTATAAAAGGACGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC528 eya-1(ok654)/hIn1 [unc-101(sy241)] I. C49A1.4. Deletion balanced by unc-101-marked inversion. Heterozygotes are WT and segregate WT, Unc-101 hIn1 homozygotes, and ok654 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
WM104 unc-101(sy216) gsk-3(nr2047)/hIn1 [unc-54(h1040)] I. Heterozygotes are WT and segregate WT, paralyzed Unc, and coilers which give only dead eggs (low brood size).