Gene Information: gcy-33
| Name | gcy-33 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F57F5.2 |
| Genetic position | V:3.57 +/- 0.001 cM |
| Genomic position | V: 11995805..12001797 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| CZ3715 | gcy-33(ok232) V. | 1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele. |
| XA2262 | gcy-33(ok232) V; gcy-31(ok296) X; qaIs2241. | qaIs2241 [gcy-36p::egl-1 + gcy-35p::GFP]; causes genetic ablation of AQR, PQR, and URX neurons. Some residual neurons in the tail remain GFP+ from the gcy-35::GFP transgene. |