| CX3695 |
kyIs140 I. |
kyIs140 [str-2::GFP + lin-15(+)] I. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX3933 |
kyIs140 I; slo-1(ky389) V. |
kyIs140 [str-2::GFP + lin-15(+)]. ky389 is semi-dominant. str-2::GFP is expressed in both AWC neurons in ky389 mutants. PKA nsy-3(ky389). |
| CX3940 |
kyIs140 I; rol-6(e187) II; slo-1(ky399) V. |
kyIs140 [str-2::GFP + lin-15(+)] I. In ky399 mutants str-2::GFP is expressed in both AWX neurons. ky399 is a semi-dominant allele of slo-1, a large conductance potassium channel. PKA nsy-3(ky399). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX4828 |
kyIs140 I; tir-1(ky388) III; him-5(e1490) V. |
kyIs140 [str-2::GFP + lin-15(+)] I. Him. In tir-1 mutants str-2::GFP is expressed in both AWC neurons. |
| CX4998 |
kyIs140 I; nsy-1(ky397) II. |
kyIs140 [str-2::GFP + lin-15(+)] I. In nsy-1 mutants str-2::GFP is expressed in both AWC neurons. |
| CX5757 |
kyIs140 I; nsy-4(ky616) IV. |
kyIs140 [str-2::GFP + lin-15(+)] I. 2-AWC OFF. |
| CX5893 |
kyIs140 I; ceh-36(ky646) X. |
kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-36 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX5922 |
kyIs140 I; ceh-36(ky640) X. |
kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-26 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| OH4768 |
kyIs140 I; ttx-3(mg158) X. |
kyIs140 [str-2::GFP + lin-15(+)] I. |
| PY1133 |
unc-130(oy10) II. |
Slighty Dpy. Slighty Unc. Ventral clear patch due to distal tip cell migration defects. Ectopic expression of AWA neuronal markers. |
| RB2316 |
str-2(ok3148) V. |
C50C10.7 Homozygous. Outer Left Sequence: tcgacctgtcaaacatcgaa. Outer Right Sequence: cgcatttgtgaacctgtttg. Inner Left Sequence: aaatcctcgtcgataacttttga . Inner Right Sequence: gcacacatatgggtctgcttt. Inner Primer PCR Length: 1212. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2413 |
str-2(ok3089) V. |
C50C10.7. External left primer: TCGACCTGTCAAACATCGAA. External right primer: CGCATTTGTGAACCTGTTTG. Internal left primer: AAATCCTCGTCGATAACTTTTGA. Internal right primer: GCACACATATGGGTCTGCTTT. Internal WT amplicon: 1213 bp. Deletion size: 409 bp. Deletion left flank: TCTATCATCTCAAGCTTTTTGGTCAGCCAA. Deletion right flank: TGAATCGAAGTCCGGAAACAAGTAGTTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |