Gene Information: odr-1
| Name | odr-1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | R01E6.1 |
| Genetic position | X:12.72 +/- 0.125 cM |
| Genomic position | X: 13544729..13550990 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| CX2065 | odr-1(n1936) X. | Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.] |
| PY2417 | oyIs44 V. | oyIs44 [odr-1::RFP + lin-15(+)]. Bright RFP in AWB and AWC. |