Gene Information: zmp-1

Namezmp-1 View on WormBase
Species C. elegans
SequenceEGAP1.3
Genetic positionIII:-1.43 +/- 0.001 cM
Genomic positionIII: 5926895..5932953

Strains carrying this gene

Strain Genotype Description
CH1315 zmp-1(cg115) III. Superficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant.
PS3728 syIs77 II. syIs77 [zmp-1::pes-10::YFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC.