Gene Information: zmp-1
| Name | zmp-1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | EGAP1.3 |
| Genetic position | III:-1.43 +/- 0.001 cM |
| Genomic position | III: 5926895..5932953 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| CH1315 | zmp-1(cg115) III. | Superficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant. |
| PS3728 | syIs77 II. | syIs77 [zmp-1::pes-10::YFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |