Gene Information: zmp-1
| Name | zmp-1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | EGAP1.3 |
| Genetic position | III:-1.43 +/- 0.001 cM |
| Genomic position | III: 5926895..5932953 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| CH1315 | zmp-1(cg115) III. | Superficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant. |
| PS3728 | syIs77 II. | syIs77 [zmp-1::pes-10::YFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC. |