| CF491 |
pry-1(mu38) I; him-5(e1490) V. |
Very sick, Muv, Scrawny. Extra rays in males in body. Ectopic expression of lin-39, mab-5, egl-5. Cold sensitive - grows better at 25C. |
| KN689 |
axl-1(tm1095) pry-1(mu38) I; muIs32 II; huEx83. |
muIs32 [mec-7p::GFP + lin-15(+)] II. huEx83 [pry-1p::axl-1::GFP + myo-2p::GFP]. Pick animals with GFP+ pharynx to maintain. Reference: Oosterveen et al. (2007) Dev Biol 308: 438-48. |
| LP713 |
pry-1(cp383[pry-1::mNG-C1^3xFlag]) I. |
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press. |
| PS5551 |
pry-1(mu38)/hIn1 [unc-54(h1040)] I; syIs188. |
syIs188 [POPTOP + unc-119(+)]. Maintain by picking non-Uncs. syIs188 suppresses pry-1(mu38) Muv phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| VC3709 |
pry-1(gk3681[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I; F56E10.1(gk3701) V. |
Homozygous viable. Primary deletion of 720 bp in pry-1 with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAGGGGCCCCTCCCGGTAGCCGGTCGAGCG; Right flanking sequence: GGATTTTTCTGCGAAATTTGGATTTAGCTT. Strain carries secondary 5-bp deletion in F56E10.1, with flanking sequences GGCGCCGGCGGTGAAGAGGATGAGGACAAT and GGATTCAGAAGAAGAAGATGAAGAAGACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |