| CF491 |
pry-1(mu38) I; him-5(e1490) V. |
Very sick, Muv, Scrawny. Extra rays in males in body. Ectopic expression of lin-39, mab-5, egl-5. Cold sensitive - grows better at 25C. |
| KN689 |
axl-1(tm1095) pry-1(mu38) I; muIs32 II; huEx83. |
muIs32 [mec-7p::GFP + lin-15(+)] II. huEx83 [pry-1p::axl-1::GFP + myo-2p::GFP]. Pick animals with GFP+ pharynx to maintain. Reference: Oosterveen et al. (2007) Dev Biol 308: 438-48. |
| LP713 |
pry-1(cp383[pry-1::mNG-C1^3xFlag]) I. |
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press. |
| PS5551 |
pry-1(mu38)/hIn1 [unc-54(h1040)] I; syIs188. |
syIs188 [POPTOP + unc-119(+)]. Maintain by picking non-Uncs. syIs188 suppresses pry-1(mu38) Muv phenotype. Do not distribute this strain; other labs should request it from the CGC. |
| VC3709 |
pry-1(gk3681[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I; F56E10.1(gk3701) V. |
Homozygous viable. Primary deletion of 720 bp in pry-1 with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAGGGGCCCCTCCCGGTAGCCGGTCGAGCG; Right flanking sequence: GGATTTTTCTGCGAAATTTGGATTTAGCTT. Strain carries secondary 5-bp deletion in F56E10.1, with flanking sequences GGCGCCGGCGGTGAAGAGGATGAGGACAAT and GGATTCAGAAGAAGAAGATGAAGAAGACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
