| CB3533 |
+/szT1 [lon-2(e678)] I; twk-18(e1913)/szT1 X. |
Heterozygotes are Unc and segregate Unc, dead eggs, and Lon males. e1913 is a dominant Unc and recessive lethal. Maintain by picking Unc. e1913 previously called unc-110. |
| CB4461 |
twk-18(e1913e2383) X. |
Wild type. previously called unc-110. |
| MT3840 |
unc-93(e1500n1415) dpy-17(e164) III; twk-18(e1913)/+ X. |
Pick DpyUnc worms to maintain, as e1913 is a dominant Unc and a recessive lethal. Actually, the Uncs are not very Dpy, so pick non-Dpy-looking animals that don't move well. e1913 previously called unc-110. |
| TN110 |
twk-18(cn110) X. |
Semi-dominant. Reversible paralysis. Straight and rigid body form at the restrictive temperature (30C); recovers to WT when the temperature is lowered. Previously called mah-2(cn110) and unc-110(cn110). See WBPaper00004376. |
| VC3930 |
twk-18(gk5009[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. |
Homozygous viable. Deletion of 3495 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCATTCTGGGCGAATTTATGATTGCCAATA; Right flanking sequence: GAAGTTGTCCGTGTTGAGCATTTCAATCAC. See WormBase Variation gk5009 for details. |