CB1416 |
unc-86(e1416) III. |
Egg-laying deficient. Lineage abnormal. Mechanosensory abnormal. M-MATING++ 1-10%WT. Serotonin def. |
CB1507 |
unc-86(e1507) III. |
HSN-. Egl. Mec. |
MT1350 |
lin-8(n111) II; lin-9(n112) unc-86(e1416) III. |
Unc. Muv. |
MT1853 |
unc-86(n843) III. |
Him. Lethargic. Mec. Egl. |
MT1855 |
unc-86(n844) III. |
Unc. Egl. Non-Him. |
MT1857 |
unc-86(n845) III. |
Unc. Non-him. |
MT1859 |
unc-86(n846) III. |
Unc. |
MT1861 |
unc-86(n847) dpy-19(e1259) III. |
Unc-Lethargic. Mec. Egl. ts Dpy. n847 has a Him phenotype. |
MT1862 |
unc-86(n848) III. |
Unc. Temperature sensitive allele. |
MT1976 |
unc-86(n946) III. |
HSN-. Egl. Mec. |
MT306 |
unc-86(n306) III. |
Bloated. Mec. Egl. Him. |
MT4917 |
unc-86(n946) ced-7(n1892) unc-50(e306) unc-49(e382) III. |
|
MT5259 |
unc-86(n946) ced-7(n1892) unc-50(e306) unc-49(e382) dpy-18(e364) III. |
|
MT5260 |
unc-86(n946) ced-7(n1892) unc-50(e306) III. |
|
MT9056 |
nDf20 III; nDp2 [unc-86(e1416)] (III;f). |
Segregates Unc-86 animals and dead eggs. |
OH12734 |
unc-86(n846) III; otEx5851. |
otEx5851 [unc-86(fosmid)::NLS::mChopti + lin-44::YFP]. Pick YFP+ to maintain. |
OH15227 |
unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID]) III. |
unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press). |