| CB1034 |
che-1(e1034) fer-1(hc1) I. |
Chemotaxis abnormal. Temperature sensitive fertilization defective. Maintain at 15C. M-MATING+++ 10-30%WT. |
| MLC2312 |
che-1(luc174) I. |
Wild-type morphology. CRISPR/Cas9 engineered 3.38 kB deletion of the che-1 locus. Flank: caaaaacatcacaaaaataa // tataatttactgatacaata Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421 |
| OH13098 |
che-1(ot75) I. |
che-1(ot75) is a null allele caused by an early STOP codon in exon 1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37. |
| OH14130 |
che-1(ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. |
ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 tagged with GFP. Nuclear GFP localization in ASE neurons. Reference: Leyva-Díaz E, et al. Genetics. 2017 Oct;207(2):529-545. |
| OH15579 |
che-1(ot908 ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. |
ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision). |
| OH15683 |
che-1(ot871 ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. |
ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision). |
| OH15815 |
che-1(ot63 ot941[che-1::SEC-GFP::TEV::3xFLAG]) I. |
ot941[che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying ot63 null alllele and tagged with GFP (che-1::SEC-GFP::TEV::3xFLAG). che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37. |
| OH2871 |
che-1(ot101) I; ntIs1 V; otIs151. |
ntIs1 [gcy-5p::GFP + lin-15(+)] V; integration of adEx1262 [gcy-5p::GFP + lin-15(+)]. otIs151 [ceh-36p::RFP + rol-6(su1006)]. Rollers. Both ASEL and ASER show GFP expression from ntIs1. |
| OH3556 |
che-1(ot124) otIs114 I. |
otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in complete loss of ASE specific cell fate markers. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant. |
| OH3679 |
che-1(ot151) otIs114 I. |
otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in complete loss of ASE specific cell fate markers. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant. |
| OH3681 |
otIs114 che-1(ot153) I. |
otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in a complete loss of ASE specific cell fate markers. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant. |
| OH4013 |
otIs114 che-1(ot232) I. |
otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in a complete loss of ASE specific cell fate markers. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant. |
| OH610 |
che-1(ot63) I; otIs3. |
otIs3 [gcy-7::GFP + lin-15(+)]. che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. otIs3 was derived by integration of adEx1288 [gcy-7::GFP + lin-15(+)]. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37. |
| OH9668 |
che-1(ot489) I; him-5(e1490) V. |
|
| PR672 |
che-1(p672) I. |
Defective in chemotaxis to Na+, OH-, NaHCO3; partially defective in chemotaxis to CL-; inverted taxis to cAMP. |
| PR674 |
che-1(p674) I. |
Defective in chemotaxis to all attractants except pyridine and D-tryptophan. Thermotaxis okay. |
| PR679 |
che-1(p679) I. |
Defective in chemotaxis to all attractants except pyridine and D-tryptophan. Thermotaxis okay. 1/2007: new stock received from Michael Ailion due to a recent Dyf mutation appearing in the old CGC stock. |
| PR680 |
che-1(p680) I. |
Defective in chemotaxis to all attractants except pyridine and D-tryptophan. Thermotaxis okay. |
| PR692 |
che-1(p692) I. |
Defective in chemotaxis to all attractants except pyridine and D-tryptophan. Partial defects in taxis to pyridine, H+(phosphate) and H+(citrate). |
| PR696 |
che-1(p696) I. |
Defective in chemotaxis to all attractants except D-tryptophan. Partially defective in response to pyridine, H+(citrate). Thermotaxis okay. |