Gene Information: che-1

Nameche-1 View on WormBase
Species C. elegans
SequenceC55B7.12
Genetic positionI:1.21 +/- 0.003 cM
Genomic positionI: 6517529..6520918

Strains carrying this gene

Strain Genotype Description
CB1034 che-1(e1034) fer-1(hc1) I. Chemotaxis abnormal. Temperature sensitive fertilization defective. Maintain at 15C. M-MATING+++ 10-30%WT.
MLC2312 che-1(luc174) I. Wild-type morphology. CRISPR/Cas9 engineered 3.38 kB deletion of the che-1 locus. Flank: caaaaacatcacaaaaataa // tataatttactgatacaata Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
OH13098 che-1(ot75) I. che-1(ot75) is a null allele caused by an early STOP codon in exon 1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37.
OH14130 che-1(ot856[che-1::gfp]) I. ot856[che-1::gfp]. Endogenous locus of che-1 tagged with GFP. Nuclear GFP localization in ASE neurons. Reference: Leyva-Díaz E, et al. Genetics. 2017 Oct;207(2):529-545.
OH15579 che-1(ot908 ot856[che-1::gfp]) I. ot856[che-1::gfp]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision).
OH15683 che-1(ot871 ot856[che-1::gfp]) I. ot856[che-1::gfp]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision).
OH15815 che-1(ot63 ot941[che-1::SEC-GFP::TEV::3xFLAG]) I. ot941[che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying ot63 null alllele and tagged with GFP (che-1::SEC-GFP::TEV::3xFLAG). che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37.
OH2871 che-1(ot101) I; ntIs1 V; otIs151. ntIs1 [gcy-5p::GFP + lin-15(+)] V; integration of adEx1262 [gcy-5p::GFP + lin-15(+)]. otIs151 [ceh-36p::RFP + rol-6(su1006)]. Rollers. Both ASEL and ASER show GFP expression from ntIs1.
OH3556 che-1(ot124) otIs114 I. otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in complete loss of ASE specific cell fate markers. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3679 che-1(ot151) otIs114 I. otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in complete loss of ASE specific cell fate markers. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3681 otIs114 che-1(ot153) I. otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in a complete loss of ASE specific cell fate markers. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH4013 otIs114 che-1(ot232) I. otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in a complete loss of ASE specific cell fate markers. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH610 che-1(ot63) I; otIs3. otIs3 [gcy-7::GFP + lin-15(+)]. che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. otIs3 was derived by integration of adEx1288 [gcy-7::GFP + lin-15(+)]. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37.
OH9668 che-1(ot489) I; him-5(e1490) V.
PR672 che-1(p672) I. Defective in chemotaxis to Na+, OH-, NaHCO3; partially defective in chemotaxis to CL-; inverted taxis to cAMP.
PR674 che-1(p674) I. Defective in chemotaxis to all attractants except pyridine and D-tryptophan. Thermotaxis okay.
PR679 che-1(p679) I. Defective in chemotaxis to all attractants except pyridine and D-tryptophan. Thermotaxis okay. 1/2007: new stock received from Michael Ailion due to a recent Dyf mutation appearing in the old CGC stock.
PR680 che-1(p680) I. Defective in chemotaxis to all attractants except pyridine and D-tryptophan. Thermotaxis okay.
PR692 che-1(p692) I. Defective in chemotaxis to all attractants except pyridine and D-tryptophan. Partial defects in taxis to pyridine, H+(phosphate) and H+(citrate).
PR696 che-1(p696) I. Defective in chemotaxis to all attractants except D-tryptophan. Partially defective in response to pyridine, H+(citrate). Thermotaxis okay.