| CB318 |
unc-30(e318) IV. |
Unc-cannot back. Recessive. |
| CB845 |
unc-30(e191) IV. |
Unc-cannot back up. |
| CGC30 |
unc-30(e191) dpy-4(e1166) IV; yDp1 [umnIs19] (IV;V;f). |
umnIs19 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type GFP+; animals that have lost the Dup are Dpy Unc GFP-. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9. |
| CGC64 |
unc-30(e191) dpy-4(e1166) IV; yDp1 [umnIs50] (IV;V;f). |
umnIs50 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type mKate2+; animals that have lost the Dup are Dpy Unc mKate2-. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9. |
| DA491 |
dpy-20(e1282) unc-30(e191) IV. |
Unc. Temperature sensitive Dpy. |
| EW45 |
smg-1(e1228) I; unc-30(e191) IV; deIs1. |
deIs1[unc-30(+) + lin-39TL::GFP (yeast DNA)]. A translational fusion of GFP to the C terminus of LIN-39. Present on a YAC. Yeast chromosomal DNA was injected and integrated. Expression is very faint. |
| EW49 |
unc-30(e191) IV; deIs12. |
deIs12[bar1p::GFP + pSC11(unc-30(+))]. Green worms that are non-Unc. |
| JIM220 |
ujIs113 II; unc-30(ok613) IV; ceh-36(ok795) X; ujEx173. |
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003. |
| JJ1238 |
unc-30(e191) mex-5(zu199) IV/nT1 (IV;V). |
Heterozygotes are WT. Embryos from unc-30 mex-5 homozygotes produce approximately the WT number of cells but do not undergo body morphogenesis and die without hatching. |
| JJ1244 |
mex-6(pk440) II; unc-30(e191) mex-5(zu199) IV/nT1 (IV;V). |
Heterozygotes are WT. Embryos from mex-6; unc-30 mex-5 homozygotes produce approximately the WT number of cells but do not undergo body morphogenesis and die without hatching. |
| MT15537 |
unc-30(e191) lin-54(n3423) IV/nT1 [qIs51] (IV;V); lin-15A(n767) X. |
Heterozygotes are Muv and GFP+ and segregate SteUncMuv GFP- and dead eggs. n3423 is PVul and sterile when alone; Muv in synMuv class A background. |
| MT5729 |
dpy-20(e1282) unc-30(e191) ced-3(n717) IV. |
Dpy (ts). Unc. Abnormal cell death. Cells that normally die survive. |
| MT6505 |
sem-4(n1378) I; unc-30(e165) IV. |
|
| SD39 |
unc-30(e596) IV. |
Unc. Allele specific suppression by smg-1(e1228), sup-5(e1464) and sup-7(st5) [in descending order of suppression]. |
| TY156 |
unc-30(e191) dpy-4(e1166) IV; yDp1 (IV;V;f). |
Animals with the Dup are WT. Animals which have lost the Dup are DpyUnc. Maintain by picking WT. |
| VC2742 |
unc-30(gk3024) Y67A10A.104(gk3025) IV; str-183(gk3061) V; ZC374.2(gk1222) X. |
ZC374.2, B0564.10, Y67A10A.104, T13F3.1. The allele gk1222 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTGGAAGTTTTGGCAGGAAT. External right primer: CTTGCGTTAATCGCATGTGT. Internal left primer: TCCAATTTGAGCGATCAGTG. Internal right primer: AGGACGCGCAGATTGTTAGT. Internal WT amplicon: 2448 bp. Deletion size: 1618 bp. Deletion left flank: CATTTTTCAGTGCTGTTTCTTCCACATTAT. Deletion right flank: TCAGATCTTCTAACTCGCGTTTCTAACTTT. The allele gk3024 was identified by CGH but not confirmed by PCR. Left flanking probe: TTTCGACTGCTGCAAATTTGGCACCTCTACCAACGTGAGTTTTACGGATA. Right flanking probe: TTGTTTGAGCTGCCGGGATGCCAGGAGGAGGGAACAGACAGAGCAGGTAT. Left deleted probe: AAAAATTATAATTTACATTTTTCCAGAGCCCAAGCTGCATTCTCCACATC. Right deleted probe: TTCCTCATCGCTCGGCCAACCTTATCAACCCTGTCAGTACAGTGGACCAC. The allele gk3025 was identified by CGH but not confirmed by PCR. Left flanking probe: GGGATTCGTGGTCGAGATTGCCAGTCCAAGGCTTGGTCGGTTTCAGGTTG. Right flanking probe: GGTTAATGTGAAACTTGATTTAACTGTTCCACGAGTATGCTTTAACAATA. Left deleted probe: TGATTCGCAAAAACAACGAATTGTATAGAACTCACACTTTAAGACATCTA. Right deleted probe: AAATTGCTTACTGACTTTGATGCAAAACAGGTGATTTTTCGGGTTCTAAA. The allele gk3061 was identified by CGH but not confirmed by PCR. Left flanking probe: CAGATTATCTCACTTACTGTTATTGCATATTGTGGGACATGTTGCTACTA. Right flanking probe: GGATCACATACTAAACTTAATTCTTTTCAGACCGCAATACCAATGCTTCT. Left deleted probe: ATATTGTGGGACATGTTGCTACTATAAAATACAACAGCAAATGAGGGTTG. Right deleted probe: ACCTACATCGTCAACTGTTCTACGCTTTGGCAATCCAGGTTTGACGCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC295 |
unc-30(ok613) IV. |
B0564.10. Unc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |