| AG226 |
rol-6(e187) unc-4 (e120)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II; him-8(e1489) IV. |
nIs190 [myo-2::GFP]. Him. Heterozygotes are wild-type GFP+ and segregate WT GFP+ heterozygotes, Rol Uncs, dead embryos, and males. nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. |
| CB187 |
rol-6(e187) II. |
Right hand Roller. Recessive. M-MATING-NO SUCCESS. |
| CF12 |
rol-6(e187) II; lin-22(n372) IV; him-5(e1490) V. |
Rollers. lin-22 and him-5 mutations affect neuroblast formation from epidermal precursor cell V5. |
| CL802 |
smg-1(cc546) I; rol-6(su1006) II. |
Rollers. Maintain under normal conditions. Standard control for CL4176; originally used CL1175 as the control, but subsequently it was found that CL1175 can produce some A-Beta. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] |
| CX3940 |
kyIs140 I; rol-6(e187) II; slo-1(ky399) V. |
kyIs140 [str-2::GFP + lin-15(+)] I. In ky399 mutants str-2::GFP is expressed in both AWX neurons. ky399 is a semi-dominant allele of slo-1, a large conductance potassium channel. PKA nsy-3(ky399). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| DA438 |
bli-4(e937) I; rol-6(e187) II; daf-2(e1368) vab-7(e1562) III; unc-31(e928) IV; dpy-11(e224) V; lon-2(e678) X. |
Linkage mapping strain. Maintain at 15C. |
| DR518 |
rol-6(su1006) unc-4(e120) II. |
RollerUnc. |
| EG1000 |
dpy-5(e61) I; rol-6(e187) II; lon-1(e1820) III. |
Dpy suppresses Rol and Lon. Strain appears to be only Dpy. Useful for mapping, especially Unc mutations. Separately, dpy-5 causes extreme dumpiness, rol-6 causes worms to roll over and lie in a "C" shape, and lon-1 worms are about 125% WT length. |
| EW23 |
unc-104(e1265) rol-6(e187) II. |
Dpy. Roller. |
| GD211 |
rol-6(e187) hlh-6(tm299) unc-4(e120) II. |
|
| GE1710 |
rol-6(e187) unc-4(e120) II. |
Roller Unc. |
| GE1712 |
vab-9(e1744) rol-6(e187) unc-4(e120) II. |
Unc. Roller. Tail whip knobbed at all stages except adult male (adult male tail tip slightly swollen). |
| HE1006 |
rol-6(su1006) II. |
Dominant Roller. |
| JJ1550 |
dpl-1(zu355) unc-4(e120)/rol-6(e187) let-23(sy97) II. |
Heterozygotes are WT and segregate WT, Uncs which give only deads egss with a Mex phenotype, and Vulvaless Rollers. sy97 is only 15% viable. |
| JK3091 |
ehn-1(q690) rol-6(e187) II. |
Rollers. About 15% have a one-armed gonad or are WP. Do not distribute this strain; other labs should request it from the CGC. |
| JW29 |
jeIs1I. |
jeIs1 [mec-7(+)::lacZ + rol-6(su1006)]. Rollers. Males will mate. |
| MDH10 |
ast-1(hd1) rol-6(e187) II; ceh-43(ot406) III; vtIs1 V. |
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. ot406 has a dopaminergic phenotype. |
| MDH91 |
ast-1(hd1) rol-6(e187) II; ceh-20(ok541) III; vtIs1 V; ceh-40(gk159) X; muEx261. |
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. muEx261 [ceh-20::GFP + odr-1::RFP]. Pick RFP+ animals to maintain. Rollers. Embryonic lethality of ceh-20(ok541); ceh-40(gk159) double mutants is rescued by muEx261. |
| ML503 |
tra-2(q276)/rol-6(e187) II; mcDf2/dpy-8(e130) X. |
Segregates WT, males, Dpy, Rol, DpyRol, dead eggs (mcDf2). Use XX tra-2 males to move mcDf2 around. mcDf2 is an approx. 500 kb deficiency removing a large chunk between mec-2 and sup-7 (non-inclusive). |
| MT2709 |
rol-6(e187n1270) II. |
Revertant. Phenotypically WT. |
| MT3751 |
dpy-5(e61) I; rol-6(e187) II; unc-32(e189) III. |
|
| OH2724 |
otIs133; otEx1545. |
otIs133 [pttx-3::RFP + unc-4(+)]. otEx1545 [F11H8.2::GFP + rol-6(su1006)]. Maintain by picking GFP+ Rollers. RFP expressed in AIY only. Reference: Wenick AS, Hobert O. Wenick AS, Hobert O. Developmental Cell. 2004 Jun;6(6):757-70. |
| OH7317 |
F21H12.1(ot86) rol-6(e187) II; ntIs1 V. |
ntIs1 [gcy-5p::GFP + lin-15(+)] V. Ectopic expression of ntIs1 in ASEL. Rollers. Whole genome sequenced strain. |
| WM79 |
rol-6(n1270) II; neEx1. |
Rollers. n1270 is phenotypically wild type. neEx1[LIT-1::GFP + rol-6(su1006)]. LIT-1::GFP has full length LIT-1 fused to GFP in a YAC. Pick Rollers to maintain. |