Gene Information: pmk-3

Namepmk-3 View on WormBase
Species C. elegans
SequenceF42G8.4
Genetic positionIV:3.63 +/- 0.002 cM
Genomic positionIV: 8139219..8143154

Strains carrying this gene

Strain Genotype Description
BS3383 pmk-3(ok169). F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.
SLR158 pmk-3(tm745) IV; dvIs67; stxEx12. dvIs67 [tbb-6p::GFP + myo-3p::dsRed]. stxEx12 [eft-3p::pmk-3 S(EE)::SL2::mCherry]. Pick animals with mCherry expression in intestinal cells. Reference: Munkacsy E, et al. PLoS Genet. 2016 Jul 15;12(7):e1006133.