Gene Information: ZK973.11
| Name | ZK973.11 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | ZK973.11 |
| Genetic position | I:-1.34 +/- 0.000 cM |
| Genomic position | I: 4379325..4381814 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| BC15430 | dpy-5(e907) I; sEx15430. | sEx15430 [rCes ZK973.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
| RG3206 | ZK973.11(ve706[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous Unc. Deletion of 2352 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gacagtatatattagcactttgagcatttt ; Right flanking sequence: tggtgcagcacggctcggcgagcaccgctt. sgRNA #1: gagcaaaaatcttcgaataa; sgRNA #2: atcaatattcacggaacagt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |